Isolation and Characterization of Brachyspira spp. from Dogs in the Czech Republic

The objectives of this study were to establish the prevalence of intestinal Spirochetes of the genus Brachyspira in Czech dogs and to determine the susceptibility of obtained B. pilosicoli isolates to selected antibacterial substances. Spirochetes were diagnosed microscopically in 23 out of 1139 samples of dogs’ excrements, primarily intended for a parasitological testing. The cultivation of positive samples provided 10 brachyspira isolates, which were, on the basis of their biochemical activity and the results of the species-specific PCR, identified as B. pilosicoli (9 isolates) and B. hyodysenteriae (1 isolate). These dogs came from households. All the 7 tested isolates B. pilosicoli were sensitive to metronidazole and doxycycline, uniformly resistant to erythromycin, partly sensitive to cefazoline, lincomicine and ampicilline except for one isolate of B. pilosicoli, which was resistant to ampicilline. The second part of study was focused on dogs with diarrhoea that came from animal shelters, where a high prevalence of 58% (10/17) of B. pilosicoli was found. Spirochetal colitis, susceptibility testing In the past, spirochetes have been observed and isolated from colonic excrements and mucosa of both healthy dogs and dogs with diarrhoea. However, the pathogenic importance of spirochetes and their role in the onset of canine diarrhoea have not been sufficiently explained until now (Pindak et al. 1965; Turek and Meyer 1978; Meyer et al. 1982; Lee and Hampson 1994; Duhamel et al. 1995, 1997, 1998, Fellstrom et al. 2001; Oxberry and Hampson 2003). Weakly haemolytic and indole-negative spirochetes colonising colon and rectum of healthy dogs were characterised by PCR method specific for 16S rRNA and MLEE (multilocus enzyme electrophoresis) and classified as a new species designated as „Brachyspira canis“. These spirochetes probably represent common canine intestinal commensals (Duhamel et al. 1998; Oxberry and Hampson 2003). Another species that has been isolated from canine and human faeces and the faeces of various animals in connection with diarrhoea and colonic infections is Brachyspira pilosicoli (Trott et al. 1996). This species tends to be detected in puppies with diarrhoea affected by a parasitic coinfection of Giardia spp. In adult dogs, it represents frequent finding also in the individuals without clinical symptoms (Turek and Meyer 1978; Duhamel et. al 1996). The cultures isolated from dogs were able to colonise chicken enterocytes via a mechanism similar to the one described in isolates of B. pilosicoli obtained from humans and pigs (Muniappa et al. 1996), which implies their pathogenic potential. Brachyspira pilosicoli is nowadays considered to be the causative agent of canine intestinal spirochetosis. Data on Brachyspira isolation from dogs came from studies on smaller groups of dogs or from sporadic cases of enteric infections documented more in detail (Oxberry and Hampson 2003; Skrzypcak et al. 2007). Reports on susceptibility of B. pilosicoli originating from dogs have appeared only rarely until now (Adachi et al. 2004). The objective of this study was to establish the prevalence of intestinal spirochetes of ACTA VET. BRNO 2010, 79: 437–442; doi:10.2754/avb201079030437 Address for correspondence: MVDr. Daniel Šperling Department of Microbiology and Immunology, University of Veterinary and Pharmaceutical Science Brno, Palackého 1-3, 612 42 Brno, Czech Republic Phone: +420 724 703583 E-mail: [email protected] http://www.vfu.cz/acta-vet/actavet.htm the genus Brachyspira in the population of individually bred dogs and those from animal shelters. Subsequently, the testing of sensitivity to antibiotics was performed for the selected isolates of B. pilosicoli. Materials and Methods Origin, sampling and analysis of faecal samples A total of 1139 field canine faecal samples were obtained in the years 2006 and 2007 by the diagnostic service of Vedilab analytika, Plzeň. The dogs originated mainly from households at the central and western part of the Czech Republic and from the Prague urban area. The dogs’ faeces were collected for parasitological testing which included lucid staining of the microscopic preparation with Victoria blue (Sigma-Aldrich, Czech Republic) (Kizerwetter-Swida et al. 2004). The samples positive for spirochetes were taken with a sterile swab and placed in a Amies Transport Medium (Oxoid, UK) and then sent to a diagnostic laboratory of the Institute of Microbiology and Immunology for cultivation. The primary isolation was performed on the selective Tryptose Soy Agar (BBL, USA) supplemented with 5% citrated sheep blood and the antibiotic supplement composed of 5 antibiotics of the following final concentrations: rifampin 12.5 μg/ml, spectinomycin 200 μg/ml, colistin 6.25 μg/ ml, vankomycin 6.25 μg/ml and cycloheximide 50 μg/ml (Kunkle et al. 1986; Dünser et al. 1997). Anaerobic cultivation ran for 7 days at 37 oC, in anaerobic jars at the atmosphere generated by the Gas generating kit (BR 038B, Oxoid) and the catalyst (BR 42, Oxoid). For the sub-cultivation of a culture of spirochetes, Wilkins Chalgren agar (Oxoid, UK) supplemented with 5% citrated sheep blood was used. All the dishes were pre-dried before use and cuts were made by scalpel on the top of agar for easier isolation of bacterial culture (Olson et al. 1996). The type of haemolysis was always specified after 4 days of cultivation on the Tryptose Soy Agar with blood. Bacterial cultures were biochemically identified on the basis of sodium hippurate hydrolysis determination and hydrolytic activity of enzymes (α-glucosidase, β-glucosidase and α-galactosidase) with the use of the diagnostic tablets (A/S Rosco, Denmark) (Fellström et al. 1995). The control strains of B. hyodysenteriae B78 (ATCC 27164T), B. pilosicoli (ATCC 51139T) were used to control biochemical reactions. Duplex PCR The Duplex PCR protocol to detect B. pilosicoli and B. hyodysenteriae designed according to La et al. (2003) was used. The method is based on the amplification of the gene segment for NADH oxidase of B. hyodysenteriae and the amplification of the 16S rRNA gene segment of B. pilosicoli gene with the help of two pairs of specific primers. The following primer pairs were used during the reaction: H1 (5 ́ACTAAAGATCCTGATGTATTTG) and H2 (5 ́CTAATAAACGTCTGCTGC) for B. hyodysenteriae and P1 (5 ́AGAGGAAAGTTTTTTGGCTTC) and P2 (5 ́GCACCTATGTTAAACGTCCTTG) for B. pilosicoli. DNA extraction was performed by boiling with the use of an extractive TE buffer. Five-day-old bacterial cultures cultivated on Wilkins-Chalgren agar with sheep blood were used for the purpose of DNA extraction. The bacterial DNA extract at the volume of 2.5 μl was added to the amplification mixture in a total volume of 25 μl, which was compounded from the buffer for PCR (1.5 mM MgCl2), 0.5 U HotStarTaq DNA Polymerase, 0.2 mM of each NTP and from specific primer pairs (H1, H2 a P1, P2). The duplex-PCR itself proceeded in the following steps: after the initial 15 min activation of HotStarTaq Polymerase at 95 oC, there were 30 cycles that consisted of denaturation under 94 oC for 30 s, annealing at 52 oC for 30 s and extension at 72 oC for 1 min. Visualisation of PCR products was performed on 1.5% agarose gel (Lachema, Czech Republic) in TBE buffer stained by ethidium bromide solution (Sigma) and the reading was carried out in UV transluminator. The distances of DNA products were compared with the standard (DNA marker 100-1000 bp, Bio-Rad Laboratories, Inc., USA). Antimicrobial susceptibility testing Susceptibility testing was routinely performed by dilution of antimicrobial agents on agar in accordance with the standard CLSI (formerly NCCLSM11-A5) methods. For the needs of testing, Wilkins-Chalgren agar with 5% of sheep blood, pre-dried and with the appropriate concentration of the tested antibiotic was used. The solutions of tested antibiotics were prepared according to the instructions (NCCLSM11-A5) and stored at -20 °C for 6 months. The media with antibiotics of various concentrations (dilution index 2, the rank of the determined concentrations was lower) were prepared on the testing day. The antibiotics were tested at the following concentrations: erythromycin (Sigma), 200–0.36 mg/ml; lincomycin (Pharmacia/Upjohn, UK), 128–0.25 mg/ml; doxycycline (CEVA), 32–0.064 mg/ml; metronidazole (Sigma-Aldrich, Czech Republic), 16–0.032 mg/ml; ampicillin (Sigma-Aldrich, Czech Republic), 128–0.25 mg/ml; cephazoline (Sigma-Aldrich, Czech Republic), 128–0.25 mg/ml. Five-day-old culture of the B. pilosicoli isolates was suspended in saline and adjusted to the turbidity of McFarland standards 0.5. The final concentration of bacterial cells was 3 × 106 CFU/ml; 20 ml of suspension was dropped on the agar surface in the form of a rosette. Thus there was a set of 5 tested isolates inoculated on each plate. The inoculum of each isolate on the agar surface reached the concentration of approximately 3 × 105 CFU/ml. Wilkins-Chalgren anaerobic agar without antibiotics was used to control the growth. After 4 days of incubation at the temperature of 37 °C in anaerobic jars, the minimal inhibitory concentration (MIC) for a given isolate was determined as the lowest concentration of an antibiotic which caused a total inhibition of growth and haemolytic activity of the bacterial culture. Each isolate was tested separately 3 ×. The individual MIC values were classified and 438